rs10500279
A SNP in the RYR1 gene on chromosome 19. Its most notable genotype is G;G: common in complete genomics
- Gene
- RYR1
- Location
- Chr 1938,544,428 (GRCh38)
- Highest magnitude
- 0.0Typical
- Tested on
- Not on consumer chips
- Minor allele frequency
- 8%
Genotypes
As shown in 23andMe and AncestryDNA files.
On SNPedia: (G;G). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Frequency
Share of each genotype in 11 HapMap populations.
- AverageG;G 81%
- European ancestry (Utah)G;G 87%
- Han Chinese (Beijing)G;G 69%
- Japanese (Tokyo)G;G 74%
- Yoruba (Nigeria)G;G 96%
- African ancestry (Southwest US)G;G 93%
- Chinese (Denver)G;G 74%
- Gujarati IndianG;G 57%
- Luhya (Kenya)G;G 91%
- Mexican ancestry (Los Angeles)G;G 83%
- Maasai (Kenya)G;G 78%
- TuscanG;G 85%
Related
Other RYR1 SNPs
- rs118192177C;TMalignant Hyperthermia susceptibilityVery important
- rs146876145C;TMalignant Hyperthermia susceptibilityVery important
- rs28933396A;Aquite likely to have central core diseaseVery important
- rs118192168A;Alikely severe central core diseaseVery important
- rs118192171AC;TTlikely severe central core diseaseVery important
- rs63749869A;Glikely severe central core diseaseVery important
- rs118192169-;TTCTACAACAAGAGCGAGGATlikely severe central core diseaseVery important
- rs193922781C;Tmalignant hyperthermiaVery important
Source and license
Adapted from rs10500279 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.