rs63749869
A SNP in the RYR1 gene on chromosome 19. Its most notable genotype is A;G: likely severe central core disease
- Gene
- RYR1
- Location
- Chr 1938,580,440 (GRCh38)
- Highest magnitude
- 4.0Very important
- Tested on
- 23andMe, AncestryDNA
Genotypes
As shown in 23andMe and AncestryDNA files.
- A;GMost notableBadlikely severe central core disease
- G;GGoodcommon in clinvar
On SNPedia: (A;G), (G;G). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Conditions, medicines and genes
Other RYR1 SNPs
- rs118192177C;TMalignant Hyperthermia susceptibilityVery important
- rs146876145C;TMalignant Hyperthermia susceptibilityVery important
- rs28933396A;Aquite likely to have central core diseaseVery important
- rs118192168A;Alikely severe central core diseaseVery important
- rs118192171AC;TTlikely severe central core diseaseVery important
- rs118192169-;TTCTACAACAAGAGCGAGGATlikely severe central core diseaseVery important
- rs193922781C;Tmalignant hyperthermiaVery important
- rs193922842C;Gmalignant hyperthermiaVery important
Notes
From SNPedia
Notes
rs63749869, aka p.Arg4861His or p.R4861H, is a SNP in the RYR1 gene associated with central core disease as well as a congenital neuromuscular disease.
A;G
May have severe muscle issues, or, may be asymptomatic.
Source and license
Adapted from rs63749869 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.