rs118192161
A SNP in the RYR1 gene on chromosome 19. Its most notable genotype is C;T: susceptibility to malignant hyperthermia
- Gene
- RYR1
- Location
- Chr 1938,444,211 (GRCh38)
- Highest magnitude
- 3.0Important
- Tested on
- AncestryDNA
Genotypes
As shown in 23andMe and AncestryDNA files.
On SNPedia: (C;C), (C;T). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Conditions, medicines and genes
Other RYR1 SNPs
- rs118192177C;TMalignant Hyperthermia susceptibilityVery important
- rs146876145C;TMalignant Hyperthermia susceptibilityVery important
- rs28933396A;Aquite likely to have central core diseaseVery important
- rs118192168A;Alikely severe central core diseaseVery important
- rs118192171AC;TTlikely severe central core diseaseVery important
- rs63749869A;Glikely severe central core diseaseVery important
- rs118192169-;TTCTACAACAAGAGCGAGGATlikely severe central core diseaseVery important
- rs193922781C;Tmalignant hyperthermiaVery important
Notes
From SNPedia
Notes
rs118192161, aka p.Arg163Cys or p.R163C, is a SNP in the RYR1 gene leading to increased susceptibility to malignant hyperthermia when heterozygous. 23andMe name: i6017661 Mutations in the ryanodine receptor gene in central core disease and malignant hyperthermia. Exome sequencing identifies GRIN2A as frequently mutated in melanoma. Exclusion of defects in the skeletal muscle specific regions of the DHPR alpha 1 subunit as frequent causes of malignant hyperthermia.
C;T
You may be at higher risk for a bad response to anesthetics.
Source and license
Adapted from rs118192161 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.