rs587778982
A SNP in the MLH1 gene on chromosome 3. Its most notable genotype is -;GAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAA : Lynch syndrome, pathogenic mutation
- Gene
- MLH1
- Location
- Chr 337,050,577 (GRCh38)
- Highest magnitude
- 6.0Very important
- Tested on
- Not on consumer chips
Genotypes
As shown in 23andMe and AncestryDNA files.
- -;-Goodcommon in clinvar
- -;GAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAA Most notableBadLynch syndrome, pathogenic mutation
On SNPedia: (-;-), (-;GAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAA ). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Other MLH1 SNPs
- rs11541859G;TLynch syndrome, pathogenic mutationVery important
- rs35001569A;TLynch syndrome, pathogenic mutationVery important
- rs41542214C;TLynch syndromeVery important
- rs63749795C;TLynch syndrome, pathogenic mutationVery important
- rs63749804-;CLynch syndrome, pathogenic mutationVery important
- rs63749813-;GALynch syndrome, pathogenic mutationVery important
- rs63749816-;CLynch syndrome, pathogenic mutationVery important
- rs63749818A;CLynch syndrome, pathogenic mutationVery important
Source and license
Adapted from rs587778982 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.