rs66698963
A SNP in the FADS2 gene on chromosome 11. Its most notable genotype is CTCCCTGCCTCCCCAGGGACTT;CTCCCTGCCTCCCCAGGGACTT: common in clinvar
- Gene
- FADS2
- Location
- Chr 1161,835,065 (GRCh38)
- Highest magnitude
- 0.0Typical
- Tested on
- Not on consumer chips
Genotypes
As shown in 23andMe and AncestryDNA files.
On SNPedia: (CTCCCTGCCTCCCCAGGGACTT;CTCCCTGCCTCCCCAGGGACTT). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Notes
From SNPedia
Notes
Basal plasma phospholipid arachidonic acid (ARA) status was 8% greater in rs66698963 I/I compared with D/D individuals, consistent with previous in vitro data suggesting that the insertion allele enhances n-6 long-chain PUFA synthesis and may confer an adaptive advantage in South Asians (and other populations having a primarily vegetarian diet). http://www.eurekalert.org/pub_releases/2016-03/mbae-aww032416.php and http://mbe.oxfordjournals.org/content/early/2016/03/09/molbev.msw049.abstract if they stray from a balanced omega-6 to omega-3 diet -- may make people more susceptible to inflammation, and by association, increased risk of heart disease and colon cancer.
Source and license
Adapted from rs66698963 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.