ABCD1

86 SNPs in the ABCD1 gene, 84 with a genotype of magnitude 2 or higher.

Type: Gene
SNPs: 86
Notable: 84Magnitude 2 or higher
Well documented: 1
Genosets: 0

ABCD1 SNPs

Every genotype, as shown in 23andMe and AncestryDNA files.

rs11156606Typical
- A;Acommon/normalGood
rs4010613Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs74315277Very important
- A;Acommon/normalGood
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs74315278Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;GCCCTCGCGGCCTATGGCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- GCCCTCGCGGCCTATGG;GCCCTCGCGGCCTATGGcommon/normalGood
rs74315280Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs128624213Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs128624214Very important
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624215Very important
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624216Very important
- A;Acommon in clinvarGood
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624217Very important
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;Tcommon in clinvarGood
rs128624218Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs128624219Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs128624220Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624221Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624222Very important
- G;Gcommon in clinvarGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624223Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624224Very important
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs128624225Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs141446687Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs145073701Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs146525445Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs150346282Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs193922093Very important
- -;-common in clinvarGood
- -;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs193922094Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;Tcommon in clinvarGood
rs193922097Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs193922098Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs201114595Very important
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs201427153Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GNo summary available.Not rated
rs201568579Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs202125585Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs373957035Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs387906494Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;AGCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- AG;AGcommon in clinvarGood
rs387906495Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon in clinvarGood
rs387906496Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;GAGCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- GAG;GAGcommon in clinvarGood
- GGA;GGAcommon in clinvarGood
rs398123100Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs398123102Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs398123103Very important
- A;APossible miscall by Ancestry; otherwise: X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GPossible miscall by Ancestry; otherwise: Carrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs398123104Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon in clinvarGood
rs398123105Very important
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs398123106Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs398123107Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs398123108Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs398123109Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;CGGGGGAACACGCTGACarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- CGGGGGAACACGCTGA;CGGGGGAACACGCTGAcommon in clinvarGood
rs398123110Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs398123111Very important
- C;Ccommon in clinvarGood
- C;TPossible Ancestry miscall; otherwise, Carrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TPossible Ancestry miscall; otherwise, X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs398123112Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;GGTGGCCCACGCCTACCGCCTCTCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- GGTGGCCCACGCCTACCGCCTCT;GGTGGCCCACGCCTACCGCCTCTcommon in clinvarGood
- TCTGGTGGCCCACGCCTACCGCC;TCTGGTGGCCCACGCCTACCGCCcommon in clinvarGood
rs398123113Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon in clinvarGood
rs713993050Very important
- -;-common in clinvarGood
- -;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs727503786Very important
- C;Ccommon in clinvarGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs781797609Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs781862879Very important
- A;Acommon/normalGood
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs781904944Very important
- G;Gcommon/normalGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs781924420Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs781948018Very important
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs781951552Very important
- G;Gcommon/normalGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782083931Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782158792Very important
- A;Acommon/normalGood
- A;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782178199Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs782230740Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs782311214Very important
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782325478Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782370364Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782509393Very important
- C;Ccommon/normalGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782567454Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs782567718Very important
- C;Ccommon/normalGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782635828Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs782726660Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
rs782747420Very important
- G;Gcommon/normalGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782760033Very important
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs797044610Very important
- A;Acommon in clinvarGood
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs797044611Very important
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;Tcommon in clinvarGood
rs797044625Very important
- -;-X-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- -;ACCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- AC;ACcommon/normalGood
- CA;CAcommon in clinvarGood
rs797044626Very important
- A;Acommon in clinvarGood
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs797044726Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs797044781Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs868911300Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon/normalGood
rs868934170Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;GX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs886044777Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
rs886044882Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;Tcommon/normalGood
rs886044887Very important
- G;Gcommon/normalGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs1057516052Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of X-linked adrenoleukodystrophy mutation; probably unaffectedBad
- C;Ccommon in clinvarGood
- C;TCarrier of X-linked adrenoleukodystrophy mutation; probably unaffectedBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs1057517954Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;CX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- C;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood
- G;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs1064793877Very important
- C;Ccommon in clinvarGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs1131691743Very important
- A;AX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
- A;CCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- C;Ccommon/normalGood
- C;TCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- T;TX-linked adrenoleukodystrophy; symptoms and age of onset highly variableBad
rs782041940Very important
- A;GCarrier of of X-linked adrenoleukodystrophy mutation; AMN symptoms possibleBad
- G;Gcommon in clinvarGood

Other SNPs

No notable genotype or detailed notes

Show 1 SNP

rs864309520

Source and license

Adapted from ABCD1 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.

SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.