rs606231139
A SNP in the COQ8A gene on chromosome 1. Its most notable genotype is TTG;TTG: Coenzyme Q10 Deficiency; severity varies
- Gene
- COQ8A
- Location
- Chr 1226,965,322 (GRCh38)
- Highest magnitude
- 5.6Very important
- Tested on
- Not on consumer chips
Genotypes
As shown in 23andMe and AncestryDNA files.
- AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCACGoodcommon in clinvar
- AATCCCCTGTTGGGGGCCTCAC;TTGBadCarrier of a coenzyme Q10 deficiency mutation
- TTG;TTGMost notableBadCoenzyme Q10 Deficiency; severity varies
On SNPedia: (AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCAC), (AATCCCCTGTTGGGGGCCTCAC;TTG), (TTG;TTG). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Conditions, medicines and genes
Other COQ8A SNPs
- rs145034527T;TPossible Coenzyme Q10 Deficiency; severity variesVery important
- rs387906298G;GCoenzyme Q10 Deficiency; severity variesVery important
- rs387906299-;-Coenzyme Q10 Deficiency; severity variesVery important
- rs578189699T;TCoenzyme Q10 Deficiency; severity variesVery important
- rs606231138C;CCoenzyme Q10 Deficiency; severity variesVery important
- rs771578775T;TCoenzyme Q10 Deficiency; severity variesVery important
- rs797045217-;-Coenzyme Q10 Deficiency; severity variesVery important
- rs886043382A;ACoenzyme Q10 Deficiency; severity variesVery important
Notes
From SNPedia
Notes
AATCCCCTGTTGGGGGCCTCAC;TTG
Unaffected in absence of a second mutation; see coenzyme Q10 deficiency
TTG;TTG
see coenzyme Q10 deficiency
Source and license
Adapted from rs606231139 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.