rs786202415
A SNP in the BRIP1 gene on chromosome 17. Its most notable genotype is -;AACAGAAGTTCAGCTTCGGTTT: Ovarian cancer susceptibility
- Gene
- BRIP1
- Location
- Chr 1761,799,189 (GRCh38)
- Highest magnitude
- 6.0Very important
- Tested on
- 23andMe, AncestryDNA
Genotypes
As shown in 23andMe and AncestryDNA files.
- -;AACAGAAGTTCAGCTTCGGTTTMost notableBadOvarian cancer susceptibility
- AACAGAAGTTCAGCTTCGGTTT;AACAGAAGTTCAGCTTCGGTTTGoodcommon in clinvar
On SNPedia: (-;AACAGAAGTTCAGCTTCGGTTT), (AACAGAAGTTCAGCTTCGGTTT;AACAGAAGTTCAGCTTCGGTTT). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Other BRIP1 SNPs
- rs137852986A;GIncreased cancer risk; ovarian cancer & relatedVery important
- rs149364097C;GOvarian cancer susceptibilityVery important
- rs368796923A;GIncreased cancer risk; ovarian cancer & relatedVery important
- rs574552037C;GIncreased cancer risk; ovarian cancer & relatedVery important
- rs575595017A;GIncreased cancer risk; ovarian cancer & relatedVery important
- rs587778134-;TTOvarian cancer susceptibilityVery important
- rs587780226A;GOvarian cancer susceptibilityVery important
- rs587780228A;CIncreased cancer risk; ovarian cancer & relatedVery important
Source and license
Adapted from rs786202415 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.