rs267608617
A SNP in the MECP2 gene on chromosome X. Its most notable genotype is -;TCTGCAAAGAGGAGAAGATGCCCAGA: Rett syndrome (if accurately called)
- Gene
- MECP2
- Location
- Chr X154,030,568 (GRCh38)
- Highest magnitude
- 6.0Very important
- Tested on
- AncestryDNA
Genotypes
As shown in 23andMe and AncestryDNA files.
- -;TCTGCAAAGAGGAGAAGATGCCCAGAMost notableBadRett syndrome (if accurately called)
- TCTGCAAAGAGGAGAAGATGCCCAGA;TCTGCAAAGAGGAGAAGATGCCCAGAGoodcommon in clinvar
On SNPedia: (-;TCTGCAAAGAGGAGAAGATGCCCAGA), (TCTGCAAAGAGGAGAAGATGCCCAGA;TCTGCAAAGAGGAGAAGATGCCCAGA). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Other MECP2 SNPs
- rs28934904A;GRett Syndrome (predicted)Very important
- rs28934906A;GRett Syndrome (predicted)Very important
- rs28934907A;GRett Syndrome (predicted)Very important
- rs28935468A;GRett Syndrome (predicted)Very important
- rs61748404C;GRett Syndrome (predicted)Very important
- rs61748421A;GRett Syndrome (predicted)Very important
- rs61749721A;GRett Syndrome (predicted)Very important
- rs61750240A;GRett Syndrome (predicted)Very important
Notes
From SNPedia
Notes
aka c.1235_1260del26 (p.Val412Glyfs) 23andMe name: i5900852, however, they incorrectly assign the deletion genotype (D;D) as the normal genotype
Source and license
Adapted from rs267608617 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.