rs751570838
A SNP in the CDKN2A gene on chromosome 9. Its most notable genotype is -;GGCTCCATGCTGCTCCCCGCCGCC: Malignant melanoma predisposing mutation
- Gene
- CDKN2A
- Location
- Chr 921,974,796 (GRCh38)
- Highest magnitude
- 5.0Very important
- Tested on
- Not on consumer chips
Genotypes
As shown in 23andMe and AncestryDNA files.
- -;GGCTCCATGCTGCTCCCCGCCGCCMost notableBadMalignant melanoma predisposing mutation
- GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCCGoodcommon/normal
On SNPedia: (-;GGCTCCATGCTGCTCCCCGCCGCC), (GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Conditions, medicines and genes
Other CDKN2A SNPs
- rs1800586A;CPancreatic cancer/Melanoma SyndromeVery important
- rs36204594G;TPancreatic cancer/Melanoma SyndromeVery important
- rs104894098A;TPancreatic cancer/Melanoma SyndromeVery important
- rs121913381A;CPancreatic cancer/Melanoma SyndromeVery important
- rs199907548A;CPancreatic cancer/Melanoma SyndromeVery important
- rs587782206-;TGGCPancreatic cancer/Melanoma SyndromeVery important
- rs730881672-;CTPancreatic cancer/Melanoma SyndromeVery important
- rs730881675-;ACCCGTGCACGACGPancreatic cancer/Melanoma SyndromeVery important
Notes
From SNPedia
Notes
rs751570838, also known as c.9_32del24, represents a rare mutation in the CDKN2A gene on chromosome 9. The rs751570838(-) allele is considered pathogenic in a dominant manner for malignant melanoma, based on sources in ClinVar and elsewhere. CDKN2A mutations may also predispose to other types of cancer.,
-;GGCTCCATGCTGCTCCCCGCCGCC
see rs751570838
Source and license
Adapted from rs751570838 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.