rs80359881
A SNP in the BRCA1 gene on chromosome 17. Its most notable genotype is -;ATGAATATTACTAATAGTG: BRCA1 variant considered pathogenic for breast cancer
- Gene
- BRCA1
- Location
- Chr 1743,093,877 (GRCh38)
- Highest magnitude
- 6.0Very important
- Tested on
- AncestryDNA
Genotypes
As shown in 23andMe and AncestryDNA files.
- -;ATGAATATTACTAATAGTGMost notableBadBRCA1 variant considered pathogenic for breast cancer
- ATGAATATTACTAATAGTG;ATGAATATTACTAATAGTGGoodcommon in clinvar
On SNPedia: (-;ATGAATATTACTAATAGTG), (ATGAATATTACTAATAGTG;ATGAATATTACTAATAGTG). Magnitude rates how notable a genotype is from 0 to 10, not how risky it is.
Related
Conditions, medicines and genes
Other BRCA1 SNPs
- rs28897696T;Tcarrier of two copies of BRCA1 variant; likely to be at high risk for breast/ovarian cancerVery important
- rs41286296A;CBRCA1 pathogenic mutation associated with breast cancerVery important
- rs62625306A;CBRCA1 pathogenic mutation associated with breast cancerVery important
- rs62625307A;GBRCA1 pathogenic mutation associated with breast cancerVery important
- i6051899A;Clikely to be BRCA1 variant pathogenic for breast cancerVery important
- rs1800747C;TBRCA1 pathogenic mutation associated with breast cancerVery important
- rs28897672A;Tconsidered a pathogenic BRCA1 breast cancer variantVery important
- rs28897686A;CBRCA1 pathogenic mutation associated with breast cancerVery important
Notes
From SNPedia
Notes
rs80359881, also known as 1755del19, c.1636_1654del and p.Met546_Gly552?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
-;ATGAATATTACTAATAGTG
See details at rs80359881.
Source and license
Adapted from rs80359881 on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.