HNF1A
69 SNPs in the HNF1A gene, 35 with a genotype of magnitude 2 or higher.
- Type
- Gene
- SNPs
- 69
- Notable
- 35Magnitude 2 or higher
- Well documented
- 4
- Genosets
- 0
HNF1A SNPs
Every genotype, as shown in 23andMe and AncestryDNA files.
- rs1169300Worth knowing
- rs1169305Worth knowing
- rs2464196Worth knowing
- rs1169310Typical
- rs137853236Important
- rs137853237Important
- rs137853239Important
- rs137853243Important
- rs137853244Important
- rs137853245Important
- rs137853246Important
- rs150513055Important
- rs193922577Important
- rs193922578Important
- rs193922580Important
- rs193922582Important
- rs193922587Important
- rs193922588Important
- rs193922589Important
- rs193922593Important
- rs193922594Important
- rs193922596Important
- rs193922597Important
- rs193922598Important
- rs193922599Important
- rs193922600Important
- rs193922602Important
- rs193922603Important
- rs193922604Important
- rs193922605Important
- rs193922606Important
- rs386134267Important
- -;TGGCGCAGCGTAAGTAATGACCCTACCCCGCATCTTCCCTGGGAGGMature onset diabetes of the young (type 3)Bad
- GAGGTGGCGCAGCGTAAGTAATGACCCTACCCCGCATCTTCCCTGG;GAGGTGGCGCAGCGTAAGTAATGACCCTACCCCGCATCTTCCCTGGcommon in clinvarGood
- I;Icommon genotypeGood
- TGGCGCAGCGTAAGTAATGACCCTACCCCGCATCTTCCCTGGGAGG;TGGCGCAGCGTAAGTAATGACCCTACCCCGCATCTTCCCTGGGAGGcommon in clinvarGood
- rs587776825Important
- rs137853241Worth knowing
- rs137853242Worth knowing
- rs137853247Worth knowing
No matches.
Related
Conditions and medicines
Other SNPs
No notable genotype or detailed notes
Show 33 SNPs
- rs735396
- rs1169286
- rs1169288
- rs1183910
- rs1800574
- rs2244608
- rs2259816
- rs2393791
- rs7310409
- rs7979473
- rs12427353
- rs137853238
- rs137853240
- rs140491072
- rs151344538
- rs151344539
- rs193922576
- rs193922591
- rs193922592
- rs563304627
- rs587780357
- rs754728827
- rs765432081
- rs769086289
- rs770577871
- rs886039386
- rs886039544
- rs893256143
- rs1057520291
- rs1057520504
- rs1057520779
- rs1057524908
- rs1064793150
Source and license
Adapted from HNF1A on SNPedia, using a snapshot taken October 16, 2026. SNPedia content is shared under CC BY-NC-SA 3.0 US, and this page is shared under the same license.
SNPedia is a community-edited wiki. Its entries can be incomplete, out of date or wrong, and nothing here is a diagnosis or medical advice. Magnitude is a community rating of how interesting a genotype is, not a risk score.